• Creator: Jade
• Population: 0
• Generation: 51
• Total Fitness: 1
• No. Votes: 1
• Avg. Fitness 1
• Created: 12/06/2019
• Genome: AGGGGCCCCACATAGACGTCAGATCCCGTCCGT
• Function:

  tan(numbers("yyy") if numbers('yyx') > 100 *(numbers("yyy")) else numbers("yxx") if product(gradient[2](numbers('yyx') if numbers("yxx") > 100 *(numbers("yyy")) else numbers("yyy")), 100 *(numbers("yyy")) if numbers('yyx') > numbers("yyy") else numbers("yxx")) > gradient[2](numbers("yxx") if numbers('yyx') > numbers("yyy") else 100 *(numbers("yyy"))) else 100 *(numbers("yyy")))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.