• Creator: guest983
• Population: 0
• Generation: 0
• Total Fitness: 5
• No. Votes: 1
• Avg. Fitness 5
• Created: 12/11/2019
• Genome: AGATTTAACAACACGCCGGCCGGCCGTCCC
• Function:

  sin(100 *(numbers('yxy')) if square(100 *(numbers('yxy'))) > numbers('yxy') else square(square(100 *(numbers('yxy')))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.