header

genetic-algorithms.com

 

Inspect global_global_0_0_23

Parents

global_global_0_0_23 has no parents. It was generated at random.

global_global_0_0_23

Image 01

  • Creator: global
  • Population: 0 (Global)
  • Generation: 0
  • Total Fitness: 54
  • No. Votes: 7
  • Avg. Fitness 7.7
  • Created: 05/19/2019
  • Genome: TAGGCATACATGAAACGTCGCGTTTACGAC
  • Function:

    sqrt(abs(numbers('ryy'))) if numbers('xry') > abs(numbers('ryy')) else numbers('ryy') if abs(numbers('ryy')) > abs(numbers('ryy')) if numbers('ryy') if sqrt(abs(numbers('ryy'))) > numbers('xry') else abs(numbers('ryy')) > sqrt(abs(numbers('ryy'))) else numbers('ryy') else sqrt(abs(numbers('ryy')))

Import to Sandbox

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.

Children

guest195_0_1_293

Image 01

Genome: ATGTAGGCATACATGAACGCTCCAGACGACGAC

sina12345_0_1_255

Image 01

Genome: GTGTAGGCATGCATGAAACGTCGCGTTTGAGACAGC

sina12345_0_1_202

Image 01

Genome: ATTTAGGCATAGCCGTTTACTCGCGAGTACGAC

sina12345_0_1_136

Image 01

Genome: TGCTAGGCATACATGTGCCCTGGCGTTTACGAC

guest30_0_1_54

Image 01

Genome: TAGGCATACATCAAATGTCGCGGTTACGAC

camrobjones_0_1_10

Image 01

Genome: GGTTAGGCATACTTGAAACTACGCGTTTACGTC

sina12345_0_1_254

Image 01

Genome: ATCGCATACATGAAACGTCGCTGAGATAGC

sina12345_0_1_252

Image 01

Genome: GGGTACGAAGATAAATTACATAGCGTTGACTCG

sina12345_0_1_229

Image 01

Genome: AATCTAGAAAACACCGGTTTTAAGGGGCACGAT

guest30_0_1_92

Image 01

Genome: CGCAACCATAACAGTCGGCACAATCGCGAGGAT

guest30_0_1_79

Image 01

Genome: TTTTGGCGAGCCGCCCCCGTAGGCGACAGA

guest30_0_1_64

Image 01

Genome: TCACATTTCGCTAAGTGCTGTTTTCTAGTG

camrobjones_0_1_36

Image 01

Genome: CACTCCGCTTACACTATAAGTACCGTTTACGTC

camrobjones_0_1_30

Image 01

Genome: TCCCTAAGTTTAGCTCGCCGCGGTTGGCGT

camrobjones_0_1_13

Image 01

Genome: TCGTGGCGACACTCTAAACGTCGGGCTGTGACC

camrobjones_0_1_11

Image 01

Genome: CCTCAGGCATACATGAAACGTCACATCTTCGAG

camrobjones_0_1_10

Image 01

Genome: CTTACAAATTATAGAATATACTCAAGCATC