header

genetic-algorithms.com

 

Inspect guest16600_0_0_22

Parents

guest16600_0_0_22 has no parents. It was generated at random.

guest16600_0_0_22

Image 01

  • Creator: guest16600
  • Population: 0
  • Generation: 0
  • Total Fitness: 2
  • No. Votes: 1
  • Avg. Fitness 2
  • Created: 06/16/2025
  • Genome: GATAGAATCCCGAAGTTTATCAAACAACCT
  • Function:

    band pass(divide(invert(numbers('rrr')), numbers('rrr'))) if divide(invert(numbers('rrr')), numbers('rrr')) > sin(band pass(divide(invert(numbers('rrr')), numbers('rrr')))) else invert(numbers('rrr'))

Import to Sandbox

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.

Children

guest16600_0_1_13

Image 01

Genome: GCGCGTTCCATCCCGAAGTTTCCCTATCGGTAC

guest16600_0_1_20

Image 01

Genome: CTTAGAATCCAAAAAGTTCACGCAGTTCCA