header

genetic-algorithms.com

 

Inspect guest16600_0_2_20

Parents

Mother

Image 01

guest16600_0_1_2

Genome: CCCCCGGCATAACCATAGGTAAGAAGTCCTTTA

Father

Image 01

guest16600_0_1_25

Genome: CAGTCTGGCCAGATCACAGAGCAATAATCCAAC

guest16600_0_2_20

Image 01

  • Creator: guest16600
  • Population: 0
  • Generation: 2
  • Total Fitness: 1
  • No. Votes: 1
  • Avg. Fitness 1
  • Created: 06/16/2025
  • Genome: AGGCCCCCTGGCCAGATCACGGTAAGAAGTCCTTAC
  • Function:

    tan(product(divide(band pass(numbers('yxy')) if numbers("per") > numbers('yxy') else minus(band pass(numbers('yxy')), numbers('yxy')), minus(band pass(numbers('yxy')), numbers('yxy'))), band pass(numbers('yxy')) if minus(band pass(numbers('yxy')), numbers('yxy')) > numbers('yxy') else numbers("per")))

Import to Sandbox

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.

Children

guest16600_0_2_20 has no children. Either it's in the last generation of its population or it was unsuccessful in the ruthless process of natural selection!