• Creator: guest1118
• Population: 0
• Generation: 0
• Total Fitness: 1
• No. Votes: 1
• Avg. Fitness 1
• Created: 02/03/2020
• Genome: ACTCGACCCATCACGCGTATGGCCGGCTTG
• Function:

  2 *(mod(product(band pass(100 *(numbers('ryy'))), 100 *(numbers('ryy'))), band pass(100 *(numbers('ryy')))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.