• Creator: guest1157
• Population: 1
• Generation: 1
• Total Fitness: 2
• No. Votes: 1
• Avg. Fitness 2
• Created: 02/16/2020
• Genome: ACAATTCGACATCTTAGTTGTGAAACCGAT
• Function:

  gradient[2](gradient[0](mod(minus(round(numbers('ryy'), numbers('ryy')), numbers('ryy')), round(numbers('ryy'), numbers('ryy')))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.