• Creator: guest1157
• Population: 1
• Generation: 1
• Total Fitness: 1
• No. Votes: 1
• Avg. Fitness 1
• Created: 02/16/2020
• Genome: TTAGTCCCAAGGACTCTGCAAGTGAGAGCA
• Function:

  product(tan(2 *(numbers('epe'))), 2 *(numbers('epe'))) if 2 *(numbers('epe')) > tan(2 *(numbers('epe'))) else numbers('epe') if product(tan(2 *(numbers('epe'))), 2 *(numbers('epe'))) > tan(2 *(numbers('epe'))) else 2 *(numbers('epe'))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.