• Creator: guest1157
• Population: 1
• Generation: 2
• Total Fitness: 1
• No. Votes: 1
• Avg. Fitness 1
• Created: 02/16/2020
• Genome: AACGACCTCCCTATGACTAATATTCCTCCCGCG
• Function:

  square(divide(sqrt(2 *(numbers("yxx"))), 2 *(numbers("yxx"))) if min(divide(sqrt(2 *(numbers("yxx"))), 2 *(numbers("yxx"))), sqrt(2 *(numbers("yxx")))) > sqrt(2 *(numbers("yxx"))) else 2 *(numbers("yxx")))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.