• Creator: guest1157
• Population: 1
• Generation: 3
• Total Fitness: 4
• No. Votes: 1
• Avg. Fitness 4
• Created: 02/16/2020
• Genome: AGTGAATGCCTTAGTAAATATAGTTCAGTTAAACCT
• Function:

  gradient[1](round(gradient[1](abs(numbers("yxx"))), abs(numbers("yxx"))) if gradient[1](abs(numbers("yxx"))) if round(gradient[1](abs(numbers("yxx"))), abs(numbers("yxx"))) > abs(numbers("yxx")) else numbers("yxx") > abs(numbers("yxx")) else gradient[1](abs(numbers("yxx"))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.