• Creator: guest16957
• Population: 0
• Generation: 0
• Total Fitness: 3
• No. Votes: 1
• Avg. Fitness 3
• Created: 07/28/2025
• Genome: GTTACTCTTCGAAATGGTATCGACGGGAGA
• Function:

  mod(noise(numbers('ryy')), numbers('ryy')) if noise(numbers('ryy')) > round(mod(noise(numbers('ryy')), numbers('ryy')), noise(numbers('ryy'))) else 2 *(round(mod(noise(numbers('ryy')), numbers('ryy')), noise(numbers('ryy'))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.