• Creator: guest16957
• Population: 0
• Generation: 0
• Total Fitness: 4
• No. Votes: 1
• Avg. Fitness 4
• Created: 07/28/2025
• Genome: CAAACGTACCCCACCCGCGGTGCGGTGAAT
• Function:

  sum(100 *(10 *(numbers('xry')) if product(10 *(numbers('xry')), numbers('xry')) > numbers('ryy') else numbers('xry')), 10 *(numbers('xry')) if numbers('ryy') > numbers('xry') else product(10 *(numbers('xry')), numbers('xry')))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.