header

genetic-algorithms.com

 

Inspect guest16957_0_1_0

Parents

Mother

Image 01

guest16957_0_0_10

Genome: TGTTGCCAAATAAAACGCGCTTATTTTCCT

Father

Image 01

guest16957_0_0_11

Genome: GTCCTAGTCCCAGCTACTTTCAGTGATGCG

guest16957_0_1_0

Image 01

  • Creator: guest16957
  • Population: 0
  • Generation: 1
  • Total Fitness: 3
  • No. Votes: 1
  • Avg. Fitness 3
  • Created: 07/28/2025
  • Genome: CTCTGTAGCCAAATAAAACGTGCTTATATTCCT
  • Function:

    min(cos(sum(logn(abs(numbers('ryy'))), abs(numbers('ryy')))) if sum(logn(abs(numbers('ryy'))), abs(numbers('ryy'))) > abs(numbers('ryy')) else logn(abs(numbers('ryy'))), cos(sum(logn(abs(numbers('ryy'))), abs(numbers('ryy')))))

Import to Sandbox

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.

Children

guest16957_0_2_17

Image 01

Genome: CAACTTGGTAGCCAAACCGCTGAATCTTGACAAAAT