header

genetic-algorithms.com

 

Inspect guest16957_0_3_25

Parents

Mother

Image 01

guest16957_0_2_6

Genome: TCGCGTAAAGAATCCTACGTCCCTGCTCGT

Father

Image 01

guest16957_0_2_19

Genome: CGCATCGGAGCCGCTTGGTGCGTTCTTAGCTCT

guest16957_0_3_25

Image 01

  • Creator: guest16957
  • Population: 0
  • Generation: 3
  • Total Fitness: 2
  • No. Votes: 1
  • Avg. Fitness 2
  • Created: 07/28/2025
  • Genome: ACTCGCATCGGAACCTCTTGGTGCATTCTTAGT
  • Function:

    2 *(round(band pass(numbers('rrr') if numbers('yxr') > numbers('xry') else numbers('rrr') if numbers('xry') > 10 *(numbers('rrr') if numbers('xry') > numbers('yxr') else numbers('rrr')) else numbers('yxr')), numbers('yxr') if numbers('rrr') > numbers('xry') else numbers('rrr') if numbers('yxr') > numbers('xry') else 10 *(numbers('rrr') if numbers('rrr') > numbers('yxr') else numbers('xry'))))

Import to Sandbox

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.

Children

guest16957_0_3_25 has no children. Either it's in the last generation of its population or it was unsuccessful in the ruthless process of natural selection!