• Creator: guest16957
• Population: 0
• Generation: 4
• Total Fitness: 6
• No. Votes: 1
• Avg. Fitness 6
• Created: 07/28/2025
• Genome: ATACGGTGAACGAAAAGTCAGAGCTTACCC
• Function:

  logn(exp(numbers("xyx") if abs(numbers('ryy')) > numbers('ryy') else 100 *(abs(numbers('ryy'))), 100 *(abs(numbers('ryy')))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.