header

genetic-algorithms.com

 

Inspect guest16957_0_5_10

Parents

Mother

Image 01

guest16957_0_4_23

Genome: AAAGTCAGTTGGCTCGCGCCCGAGGCTTTCTCT

Father

Image 01

guest16957_0_4_23

Genome: AAAGTCAGTTGGCTCGCGCCCGAGGCTTTCTCT

guest16957_0_5_10

Image 01

  • Creator: guest16957
  • Population: 0
  • Generation: 5
  • Total Fitness: 4
  • No. Votes: 1
  • Avg. Fitness 4
  • Created: 07/28/2025
  • Genome: AAAGTCAGTTGGCTCGCGCCCCAGGCTTTCTCT
  • Function:

    abs(numbers('yyx') if numbers('rep') > numbers('xyy') else numbers("xyx") if numbers('yyx') > numbers("xyx") else min(numbers("xyx") if numbers('yyx') > numbers('rep') else numbers('xyy'), numbers('yyx')) if min(numbers('yyx') if numbers('xyy') > numbers('rep') else numbers("xyx"), numbers('yyx')) > numbers("xyx") if numbers('xyy') > numbers('yyx') else numbers('rep') else gradient[1](numbers("xyx") if numbers('yyx') > numbers('yyx') if numbers('xyy') > numbers("xyx") else numbers('rep') else min(numbers('xyy') if numbers('yyx') > numbers('rep') else numbers("xyx"), numbers('yyx'))))

Import to Sandbox

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.

Children

guest16957_0_5_10 has no children. Either it's in the last generation of its population or it was unsuccessful in the ruthless process of natural selection!