• Creator: guest1184
• Population: 0
• Generation: 0
• Total Fitness: 5
• No. Votes: 1
• Avg. Fitness 5
• Created: 02/25/2020
• Genome: TCTACCGGCACGAGCGTTTCTAACTATACT
• Function:

  100 *(cos(numbers('rrr'))) if cos(numbers('rrr')) > numbers('rrr') else numbers('xyy') if 10 *(numbers('rrr') if 100 *(cos(numbers('rrr'))) > numbers('xyy') else cos(numbers('rrr'))) > cos(numbers('rrr')) else 100 *(cos(numbers('rrr')))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.