• Creator: guest1202
• Population: 0
• Generation: 0
• Total Fitness: 6
• No. Votes: 1
• Avg. Fitness 6
• Created: 02/29/2020
• Genome: GTGAGCTACACTAGAATGGACTATTTGTTA
• Function:

  sin(numbers('epe')) if cos(numbers('epe') if 2 *(sin(numbers('epe'))) > numbers("xxy") else sin(numbers('epe'))) > 2 *(sin(numbers('epe'))) else sin(numbers('epe')) if numbers('epe') > numbers("xxy") else 2 *(sin(numbers('epe')))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.