• Creator: guest63
• Population: 0
• Generation: 2
• Total Fitness: 3
• No. Votes: 1
• Avg. Fitness 3
• Created: 05/19/2019
• Genome: CGTCAGCAAACCAGACATAAGAACCCGTCG
• Function:

  log(minus(sum(10 *(sin(numbers("yxx"))), sin(numbers("yxx"))), 10 *(sin(numbers("yxx")))), sum(10 *(sin(numbers("yxx"))), sin(numbers("yxx"))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.