• Creator: guest18247
• Population: 0
• Generation: 0
• Total Fitness: 1
• No. Votes: 1
• Avg. Fitness 1
• Created: 01/09/2026
• Genome: AGCGGCCCACCGACGTTGGGATATCCCGTT
• Function:

  cos(product(divide(100 *(numbers('epe')), numbers('epe')), 100 *(numbers('epe'))) if divide(100 *(numbers('epe')), numbers('epe')) > numbers('epe') else 100 *(numbers('epe')))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.