header

genetic-algorithms.com

 

Inspect guest18247_0_0_19

Parents

guest18247_0_0_19 has no parents. It was generated at random.

guest18247_0_0_19

Image 01

  • Creator: guest18247
  • Population: 0
  • Generation: 0
  • Total Fitness: 1
  • No. Votes: 1
  • Avg. Fitness 1
  • Created: 01/09/2026
  • Genome: GTACTTGAAACTTTAGCAGCTGGGGCACGG
  • Function:

    numbers("yyy") if numbers('xyy') > numbers("yyy") else numbers('yxr') if round(numbers("yyy") if numbers('xyy') > numbers('xyy') if numbers("yyy") > numbers('yxr') else numbers("yyy") else 2 *(numbers("yyy") if numbers("yyy") > numbers('yxr') else numbers('xyy')), 2 *(numbers("yyy") if numbers("yyy") > numbers('xyy') else numbers('yxr'))) > numbers('xyy') if 2 *(numbers('yxr') if numbers('xyy') > numbers("yyy") else numbers("yyy")) > numbers("yyy") else numbers('xyy') if numbers('yxr') > numbers("yyy") else numbers("yyy") else 2 *(numbers("yyy") if numbers('yxr') > numbers('xyy') else numbers("yyy"))

Import to Sandbox

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.

Children

guest18247_0_0_19 has no children. Either it's in the last generation of its population or it was unsuccessful in the ruthless process of natural selection!