• Creator: guest18529
• Population: 0
• Generation: 2
• Total Fitness: 4
• No. Votes: 1
• Avg. Fitness 4
• Created: 02/17/2026
• Genome: ACCAGCACGACACTCTCCGTACGAATGGCG
• Function:

  10 *(cos(100 *(gradient[2](min(numbers('yyx'), numbers("per"))))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.