• Creator: guest18529
• Population: 0
• Generation: 4
• Total Fitness: 2
• No. Votes: 1
• Avg. Fitness 2
• Created: 02/17/2026
• Genome: ACCACCACGAAGCCCCCCGGACGAATTCCG
• Function:

  10 *(10 *(100 *(invert(product(numbers('yyx'), numbers("xxr"))))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.