• Creator: guest18529
• Population: 0
• Generation: 7
• Total Fitness: 1
• No. Votes: 1
• Avg. Fitness 1
• Created: 02/18/2026
• Genome: GACCCTATCATTACGTAACCTAGAGTGGGG
• Function:

  band pass(gradient[0](100 *(numbers("xxx")))) if 100 *(numbers("xxx")) > gradient[0](100 *(numbers("xxx"))) else divide(band pass(gradient[0](100 *(numbers("xxx")))), gradient[0](100 *(numbers("xxx"))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.