• Creator: guest18529
• Population: 0
• Generation: 8
• Total Fitness: 9
• No. Votes: 1
• Avg. Fitness 9
• Created: 02/18/2026
• Genome: TGTTACACCAGCACCATTTAAAACTCGTCGACCGTG
• Function:

  10 *(gradient[0](numbers("xxx"))) if cos(10 *(gradient[0](numbers("xxx")))) if 10 *(gradient[0](numbers("xxx"))) > gradient[0](numbers("xxx")) else 10 *(cos(10 *(gradient[0](numbers("xxx"))))) > 10 *(cos(10 *(gradient[0](numbers("xxx"))))) else cos(10 *(gradient[0](numbers("xxx"))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.