• Creator: guest18657
• Population: 0
• Generation: 0
• Total Fitness: 1
• No. Votes: 1
• Avg. Fitness 1
• Created: 03/07/2026
• Genome: ATTATACGTGGTACTGGGCTGCCGCGTGGC
• Function:

  gradient[0](logn(log(numbers('yxr') if numbers('epe') > numbers('yxy') else 2 *(numbers('yxr')), 2 *(numbers('yxr')))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.