• Creator: guest19229
• Population: 0
• Generation: 0
• Total Fitness: 7
• No. Votes: 1
• Avg. Fitness 7
• Created: 04/30/2026
• Genome: CGAAGCTTCCCAACGCCTTTAGTCAGGCTC
• Function:

  mod(cos(numbers("per") if numbers('xyy') > 100 *(numbers('xyy')) else product(100 *(numbers('xyy')), numbers('xyy'))), product(100 *(numbers('xyy')), numbers('xyy')) if numbers('xyy') > numbers("per") else 100 *(numbers('xyy')))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.