• Creator: guest19229
• Population: 0
• Generation: 0
• Total Fitness: 2
• No. Votes: 1
• Avg. Fitness 2
• Created: 04/30/2026
• Genome: AAGCACTGAAGTACGTGCTCCTGACCTCAA
• Function:

  invert(sum(numbers('xry') if gradient[1](100 *(numbers('xry'))) > numbers('yyx') else 100 *(numbers('xry')), gradient[1](100 *(numbers('xry')))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.