• Creator: guest63
• Population: 0
• Generation: 7
• Total Fitness: 2
• No. Votes: 1
• Avg. Fitness 2
• Created: 05/19/2019
• Genome: GGGACATGGAGAACTATGCGTACGTAACGC
• Function:

  2 *(numbers('epe')) if sin(2 *(numbers('epe'))) > numbers('ryy') else numbers('epe') if gradient[2](sin(2 *(numbers('epe'))) if 2 *(numbers('epe')) > numbers('ryy') else numbers('epe')) > sin(2 *(numbers('epe'))) else 2 *(numbers('epe'))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.