header

genetic-algorithms.com

 

Inspect sina12345_0_1_1

Parents

Mother

Image 01

sina12345_0_0_6

Genome: CTGCGGACGAGCTAATATAGCACTCGCAAG

Father

Image 01

sina12345_0_0_3

Genome: TCCGGTCGCCTCCGTAAGTACTTCGACAAT

sina12345_0_1_1

Image 01

  • Creator: sina12345
  • Population: 0
  • Generation: 1
  • Total Fitness: 5
  • No. Votes: 1
  • Avg. Fitness 5
  • Created: 05/19/2019
  • Genome: TGACTGCGGACGAGCGAATACAGCACTCGCAAC
  • Function:

    mean(exp(100 *(cos(numbers('xyy') if numbers('xry') > numbers('xry') else numbers("xxy"))), cos(numbers('xry') if numbers('xry') > numbers("xxy") else numbers('xyy'))), 100 *(cos(numbers('xry') if numbers("xxy") > numbers('xyy') else numbers('xry')))) if 100 *(cos(numbers('xyy') if numbers("xxy") > numbers('xry') else numbers('xry'))) > exp(100 *(cos(numbers('xry') if numbers('xyy') > numbers("xxy") else numbers('xry'))), cos(numbers('xry') if numbers('xry') > numbers("xxy") else numbers('xyy'))) else cos(numbers('xry') if numbers("xxy") > numbers('xyy') else numbers('xry'))

Import to Sandbox

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.

Children

sina12345_0_2_19

Image 01

Genome: CAGCTGCTGACGAGCTTATATAGCAGCACTAAG

sina12345_0_2_17

Image 01

Genome: TATCCACTGCGGACGTAATATTGCACTCGCAAG