header

genetic-algorithms.com

 

Inspect sina12345_0_1_23

Parents

Mother

Image 01

sina12345_0_0_6

Genome: CTGCGGACGAGCTAATATAGCACTCGCAAG

Father

Image 01

sina12345_0_0_6

Genome: CTGCGGACGAGCTAATATAGCACTCGCAAG

sina12345_0_1_23

Image 01

  • Creator: sina12345
  • Population: 0
  • Generation: 1
  • Total Fitness: 9
  • No. Votes: 1
  • Avg. Fitness 9
  • Created: 05/19/2019
  • Genome: CTGCGGACGAGCTAATATTGCACTCGCAAT
  • Function:

    mean(exp(100 *(cos(numbers('xry') if numbers('xry') > numbers('xyy') else numbers("yxx"))), cos(numbers('xry') if numbers('xyy') > numbers('xry') else numbers("yxx"))), 100 *(cos(numbers('xyy') if numbers('xry') > numbers("yxx") else numbers('xry'))))

Import to Sandbox

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.

Children

sina12345_0_2_26

Image 01

Genome: TTCCTGCGGACGAGCTAATATTCCACTCGCAAT

sina12345_0_2_17

Image 01

Genome: TATCCACTGCGGACGTAATATTGCACTCGCAAG

sina12345_0_2_13

Image 01

Genome: ACGCTGCGGACGATGGTCCGTTACACTCGCAAT

sina12345_0_2_0

Image 01

Genome: CTGCCTCACAGCTAATAATGCACTCGCAAT

sina12345_0_2_22

Image 01

Genome: GACGGTCGCCAGAATCCCGCCTGGGTGACCGCC

sina12345_0_2_11

Image 01

Genome: GTCGCGATATACCAATATTGCCCTGTGAGA