• Creator: guest21789
• Population: 0
• Generation: 3
• Total Fitness: 9
• No. Votes: 1
• Avg. Fitness 9
• Created: 09/28/2026
• Genome: CGCAGTTCATAGACCCTCGAGATGGTTGCGGTT
• Function:

  round(gradient[1](10 *(min(numbers("xyx"), numbers('epe'))) if numbers("xyx") > min(numbers("xyx"), numbers('epe')) else numbers("xyx") if min(numbers("xyx"), numbers('epe')) > 10 *(min(numbers("xyx"), numbers('epe'))) else numbers('epe')), numbers("xyx") if 10 *(min(numbers("xyx"), numbers('epe'))) if numbers('epe') > min(numbers("xyx"), numbers('epe')) else numbers("xyx") > min(numbers("xyx"), numbers('epe')) else 10 *(min(numbers("xyx"), numbers('epe'))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.