header

genetic-algorithms.com

 

Inspect sina12345_0_3_10

Parents

Mother

Image 01

sina12345_0_2_29

Genome: ACAAACCGGATTAAGCTGGTTGTAGTGACC

Father

Image 01

sina12345_0_2_7

Genome: TAGGCATGCGACCGTAATGGCAGAAGTTGCTCG

sina12345_0_3_10

Image 01

  • Creator: sina12345
  • Population: 0
  • Generation: 3
  • Total Fitness: 7
  • No. Votes: 1
  • Avg. Fitness 7
  • Created: 05/19/2019
  • Genome: CAAACAAACCGCGACCGTAATGGCATAGTGACC
  • Function:

    sum(gradient[2](square(round(numbers('xry') if numbers("yxx") > log(numbers("yxx"), numbers('xry')) else numbers("per"), log(numbers("yxx"), numbers('xry'))))), square(round(numbers("yxx") if log(numbers("yxx"), numbers('xry')) > numbers("per") else numbers('xry'), log(numbers("yxx"), numbers('xry')))))

Import to Sandbox

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.

Children

sina12345_0_4_0

Image 01

Genome: GTCGCATTAATCCTTGTGCGCTGATATACTCAG

sina12345_0_4_8

Image 01

Genome: TTAATCGAGATATATTACCTCCCCTGCTTGAGA

sina12345_0_4_21

Image 01

Genome: GGAATCTACGCCGTCCGTAATGGTAACATGAGA