• Creator: sina12345
• Population: 0
• Generation: 3
• Total Fitness: 1
• No. Votes: 1
• Avg. Fitness 1
• Created: 05/19/2019
• Genome: CCACTGCCTCACACGATGGAATGCACTCGCAAA
• Function:

  product(mean(divide(sum(100 *(sqrt(numbers("xxx"))), sqrt(numbers("xxx"))), 100 *(sqrt(numbers("xxx")))), sum(100 *(sqrt(numbers("xxx"))), sqrt(numbers("xxx")))), divide(sum(100 *(sqrt(numbers("xxx"))), sqrt(numbers("xxx"))), 100 *(sqrt(numbers("xxx")))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.