• Creator: sina12345
• Population: 0
• Generation: 5
• Total Fitness: 10
• No. Votes: 1
• Avg. Fitness 10
• Created: 05/19/2019
• Genome: AAGTCCAAACCGCAGACCCTCCTGTCCTCGGCA
• Function:

  invert(minus(10 *(numbers('rep')), numbers('rep')) if 10 *(numbers('rep')) > abs(divide(minus(10 *(numbers('rep')), numbers('rep')), 10 *(numbers('rep')))) else divide(minus(10 *(numbers('rep')), numbers('rep')), 10 *(numbers('rep'))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.