header

genetic-algorithms.com

 

Inspect sina12345_0_8_5

Parents

Mother

Image 01

sina12345_0_7_10

Genome: CATGTTCACGAGATGTCATGGGGCTCGGAAGGG

Father

Image 01

sina12345_0_7_16

Genome: CGAAGGGCTGTAAAACTTGTGTGTTGATATCTACTA

sina12345_0_8_5

Image 01

  • Creator: sina12345
  • Population: 0
  • Generation: 8
  • Total Fitness: 3
  • No. Votes: 1
  • Avg. Fitness 3
  • Created: 05/19/2019
  • Genome: CTTCAAGTTCACGAGATGTTTGTGTGTTGATAAGGG
  • Function:

    round(sum(sum(numbers('epe') if numbers('ryy') > sqrt(numbers('rrr')) else numbers('rrr'), sqrt(numbers('rrr'))) if numbers('epe') if sqrt(numbers('rrr')) > numbers('ryy') else numbers('rrr') > sqrt(numbers('rrr')) else numbers('rrr'), sum(numbers('ryy') if numbers('epe') > sqrt(numbers('rrr')) else numbers('rrr'), sqrt(numbers('rrr')))), sum(numbers('rrr') if numbers('ryy') > numbers('epe') else sqrt(numbers('rrr')), sqrt(numbers('rrr'))) if numbers('epe') if numbers('rrr') > sqrt(numbers('rrr')) else numbers('ryy') > numbers('rrr') else sqrt(numbers('rrr')))

Import to Sandbox

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.

Children

sina12345_0_9_20

Image 01

Genome: TCGCTTCCATGACAATAGTTACGATTTCTCTGCTAAGGG

sina12345_0_9_14

Image 01

Genome: TCGCGTAGCGTTCGTCTCGATAGAGATATTATTACT

sina12345_0_9_13

Image 01

Genome: TGCCAGGGATTGGCTATGGACTCATGATAAATC

sina12345_0_9_4

Image 01

Genome: TTCCAAGTGTGAACGGACCACTCTTTGTCTGTACGA