• Creator: camrobjones
• Population: 2
• Generation: 0
• Total Fitness: 2
• No. Votes: 1
• Avg. Fitness 2
• Created: 05/19/2019
• Genome: TATGAGAAACTGACTCACGGCGTGGCAGGC
• Function:

  mean(2 *(numbers("xxy")), numbers("xxy")) if numbers("xxy") if mean(2 *(numbers("xxy")), numbers("xxy")) > 2 *(numbers("xxy")) else abs(mean(2 *(numbers("xxy")), numbers("xxy"))) > 2 *(numbers("xxy")) else abs(mean(2 *(numbers("xxy")), numbers("xxy")))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.