• Creator: sina12345
• Population: 0
• Generation: 8
• Total Fitness: 2
• No. Votes: 1
• Avg. Fitness 2
• Created: 05/19/2019
• Genome: CAAGCAACGCACCGCAATAGCGGACTAAGTACT
• Function:

  sum(100 *(sum(round(noise(numbers('xry')), numbers('xry')), noise(numbers('xry')))) if sum(round(noise(numbers('xry')), numbers('xry')), noise(numbers('xry'))) > noise(numbers('xry')) else round(noise(numbers('xry')), numbers('xry')), 100 *(sum(round(noise(numbers('xry')), numbers('xry')), noise(numbers('xry')))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.