• Creator: camrobjones
• Population: 2
• Generation: 0
• Total Fitness: 7
• No. Votes: 1
• Avg. Fitness 7
• Created: 05/19/2019
• Genome: GTCACACCCACGAGACCGTGTCGACATTTG
• Function:

  sin(numbers('yxy')) if gradient[2](product(100 *(sin(numbers('yxy'))), sin(numbers('yxy')))) > 100 *(sin(numbers('yxy'))) else product(100 *(sin(numbers('yxy'))), sin(numbers('yxy')))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.