• Creator: guest1650
• Population: 0
• Generation: 0
• Total Fitness: 3
• No. Votes: 1
• Avg. Fitness 3
• Created: 05/16/2020
• Genome: AGACGAGCATCGATTAGCCTACTCGCACCT
• Function:

  sin(mod(numbers('xry') if numbers('rep') > numbers("per") else gradient[0](numbers('xry')) if numbers('xry') > numbers("per") else gradient[0](numbers('xry')), numbers('xry') if numbers("per") > numbers('rep') else gradient[0](numbers('xry'))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.