header

genetic-algorithms.com

 

Inspect guest66_0_0_22

Parents

guest66_0_0_22 has no parents. It was generated at random.

guest66_0_0_22

Image 01

  • Creator: guest66
  • Population: 0
  • Generation: 0
  • Total Fitness: 1
  • No. Votes: 1
  • Avg. Fitness 1
  • Created: 05/19/2019
  • Genome: GAGGAATACCTAGTACAGCCGACTATGCCG
  • Function:

    numbers('yxy') if numbers('epe') > numbers('xyy') else numbers("xyx") if numbers("xyx") if numbers('yxy') if numbers('epe') > numbers("xyx") else numbers('xyy') if max(numbers('xyy') if numbers("xyx") > numbers('yxy') else numbers('epe'), numbers("xyx")) > numbers("xyx") else numbers('yxy') > max(numbers('epe') if numbers('yxy') > numbers("xyx") else numbers('xyy'), numbers("xyx")) else numbers('epe') if numbers('xyy') > numbers("xyx") else numbers('yxy') > numbers('yxy') if numbers('xyy') > numbers('epe') else numbers("xyx") if numbers('yxy') > numbers("xyx") else max(numbers("xyx") if numbers('yxy') > numbers('epe') else numbers('xyy'), numbers("xyx")) else max(numbers('yxy') if numbers("xyx") > numbers('epe') else numbers('xyy'), numbers("xyx"))

Import to Sandbox

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.

Children

guest66_0_0_22 has no children. Either it's in the last generation of its population or it was unsuccessful in the ruthless process of natural selection!