• Creator: guest1650
• Population: 0
• Generation: 1
• Total Fitness: 2
• No. Votes: 1
• Avg. Fitness 2
• Created: 05/16/2020
• Genome: GTACGCCACGTCACCCCCCTGTCTCATGTT
• Function:

  sum(numbers('yyx') if numbers('xyy') > numbers('epe') else 10 *(numbers('yyx')), 10 *(numbers('yyx'))) if 10 *(numbers('yyx')) if numbers('xyy') > numbers('yyx') else numbers('epe') > round(sum(10 *(numbers('yyx')) if numbers('epe') > numbers('yyx') else numbers('xyy'), 10 *(numbers('yyx'))), numbers('epe') if 10 *(numbers('yyx')) > numbers('xyy') else numbers('yyx')) else 10 *(numbers('yyx'))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.