• Creator: guest1650
• Population: 0
• Generation: 1
• Total Fitness: 2
• No. Votes: 1
• Avg. Fitness 2
• Created: 05/16/2020
• Genome: GTACGCCACGTCACCCCCCTGTCTCATGTT
• Function:

  numbers('epe') if 10 *(numbers('yyx')) > numbers('yyx') else numbers('xyy') if 10 *(numbers('yyx')) > round(sum(numbers('xyy') if 10 *(numbers('yyx')) > numbers('epe') else numbers('yyx'), 10 *(numbers('yyx'))), 10 *(numbers('yyx')) if numbers('yyx') > numbers('epe') else numbers('xyy')) else sum(numbers('epe') if 10 *(numbers('yyx')) > numbers('xyy') else numbers('yyx'), 10 *(numbers('yyx')))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.