header

genetic-algorithms.com

 

Inspect guest1650_0_1_7

Parents

Mother

Image 01

guest1650_0_0_29

Genome: AGCTTCAATCCGCTAACCGCGATCGCGAAC

Father

Image 01

guest1650_0_0_10

Genome: TGGCTAGCCTGGGGCTAGGTGCTGTGATCA

guest1650_0_1_7

Image 01

  • Creator: guest1650
  • Population: 0
  • Generation: 1
  • Total Fitness: 9
  • No. Votes: 1
  • Avg. Fitness 9
  • Created: 05/16/2020
  • Genome: AGCTTCAATCCGCTAACCGTGCTGGCGAAC
  • Function:

    cos(noise(divide(max(numbers('yyx'), numbers('epe')), numbers('yyx'))) if max(numbers('yyx'), numbers('epe')) > numbers('yyx') else divide(max(numbers('yyx'), numbers('epe')), numbers('yyx')))

Import to Sandbox

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.

Children

guest1650_0_2_3

Image 01

Genome: CCTAGATACAATCCGCTAACCGTGCTAGCGAAC

guest1650_0_2_10

Image 01

Genome: ACCTTCAATCTGCTACCCGTGCTGATGTAC

guest1650_0_2_13

Image 01

Genome: AGCATCAATCCGCTAACCGTACTGGCGAAC

guest1650_0_2_14

Image 01

Genome: AGCTTTATTCCGCTACCCGTGCTGGCGAAC

guest1650_0_2_14

Image 01

Genome: AGCTTTATTCCGCTACCCGTGCTGGCGAAC