• Creator: guest1650
• Population: 0
• Generation: 1
• Total Fitness: 1
• No. Votes: 1
• Avg. Fitness 1
• Created: 05/16/2020
• Genome: ATTCAACGAGAAACTTAAGTAGCAGCCTGG
• Function:

  gradient[0](sum(mod(numbers("per") if 2 *(numbers("xxx")) > numbers("xxx") else numbers("yyy"), 2 *(numbers("xxx"))), numbers("per") if numbers("yyy") > numbers("xxx") else 2 *(numbers("xxx"))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.