• Creator: sina12345
• Population: 1
• Generation: 0
• Total Fitness: 4
• No. Votes: 1
• Avg. Fitness 4
• Created: 05/19/2019
• Genome: AGCATCCCATTAAGTCGAGCGCCAAGCACA
• Function:

  cos(band pass(product(numbers('yxy') if numbers("yyy") > numbers("xxr") else gradient[1](numbers("xxr")), gradient[1](numbers("xxr")))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.