• Creator: sina12345
• Population: 1
• Generation: 0
• Total Fitness: 7
• No. Votes: 1
• Avg. Fitness 7
• Created: 05/19/2019
• Genome: CACCCCCTCTACACGTAGTCGTAGGTTCCG
• Function:

  sum(product(min(numbers("xyx") if numbers('yxy') > 100 *(numbers("xyx")) else numbers("xyx"), 100 *(numbers("xyx"))), numbers("xyx") if numbers("xyx") > numbers('yxy') else 100 *(numbers("xyx"))), min(100 *(numbers("xyx")) if numbers("xyx") > numbers('yxy') else numbers("xyx"), 100 *(numbers("xyx"))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.