• Creator: guest1771
• Population: 0
• Generation: 0
• Total Fitness: 8
• No. Votes: 1
• Avg. Fitness 8
• Created: 06/06/2020
• Genome: TGGCCATGCAGTAGACCTAGATCGAGGTAA
• Function:

  sin(numbers('xyy')) if gradient[1](sin(numbers('xyy'))) > numbers('xyy') if gradient[1](sin(numbers('xyy'))) > sin(numbers('xyy')) else numbers("xxr") else product(numbers("xxr") if numbers('xyy') > sin(numbers('xyy')) else gradient[1](sin(numbers('xyy'))), gradient[1](sin(numbers('xyy'))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.