header

genetic-algorithms.com

 

Inspect guest1771_0_0_17

Parents

guest1771_0_0_17 has no parents. It was generated at random.

guest1771_0_0_17

Image 01

  • Creator: guest1771
  • Population: 0
  • Generation: 0
  • Total Fitness: 10
  • No. Votes: 1
  • Avg. Fitness 10
  • Created: 06/06/2020
  • Genome: AAATTGCTACTCAATCGGCGAGTTCTCATC
  • Function:

    abs(min(noise(numbers('yxr')), numbers('yxr')) if max(min(noise(numbers('yxr')), numbers('yxr')), noise(numbers('yxr'))) > numbers('yxr') else noise(numbers('yxr')))

Import to Sandbox

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.

Children

guest1771_0_1_1

Image 01

Genome: AAATTGCTACTTCGAACGCGAGTTCTCATC

guest1771_0_1_8

Image 01

Genome: ATAAAATTGCTTCTCAATCATCGAGTTCTCATC

guest1771_0_1_22

Image 01

Genome: GAAAAATTGCTACTAAATCGGCACTAGGTCTCC