header

genetic-algorithms.com

 

Inspect global_global_0_0_33

Parents

global_global_0_0_33 has no parents. It was generated at random.

global_global_0_0_33

Image 01

  • Creator: global
  • Population: 0 (Global)
  • Generation: 0
  • Total Fitness: 44
  • No. Votes: 7
  • Avg. Fitness 6.3
  • Created: 05/19/2019
  • Genome: GCTAGTTGCTTTCCGAAGTGGCGCACTCCT
  • Function:

    numbers('xry') if divide(numbers("xyx"), numbers('yxr')) > numbers('yxr') else numbers("xyx") if numbers("xyx") > numbers('yxr') else divide(numbers("xyx"), numbers('yxr')) if divide(numbers("xyx"), numbers('yxr')) > gradient[1](numbers('yxr') if divide(numbers("xyx"), numbers('yxr')) > numbers("xyx") else numbers('xry') if numbers("xyx") > divide(numbers("xyx"), numbers('yxr')) else numbers('yxr')) else numbers("xyx") if numbers('yxr') > numbers('xry') else divide(numbers("xyx"), numbers('yxr'))

Import to Sandbox

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.

Children

guest200_0_1_336

Image 01

Genome: GCTAGTGGCTTGTCCAAGGGGCGCACACTT

guest195_0_1_287

Image 01

Genome: GCTAGTTGCTTTCCGAAGAGGCGCACTCCT

guest75_0_1_273

Image 01

Genome: GGAGCTAGTTGGTTTCCGAAGTGGCGCACTAGT

sina12345_0_1_217

Image 01

Genome: GGAGCGAATAAGTGGAAGTGGCGCACTCCT

sina12345_0_1_155

Image 01

Genome: GCTAGTTGCTGTCCGAAGTGGCGCACCGCT

camrobjones_0_1_16

Image 01

Genome: CTTGCAAATCGCTCGCACCGGCGGGCTGTGACT

guest195_0_1_287

Image 01

Genome: GCTAGTTGCTTTCCGAAGAGGCGCACTCCT

guest94_0_1_278

Image 01

Genome: TAAAGCGTGCTGATTGACAAGTGGCGCACCAAA

sina12345_0_1_244

Image 01

Genome: TACGTATGACCTAATCTCTAAACAGATGTTGTT

sina12345_0_1_242

Image 01

Genome: AAGAGTATATGGGCATTGAAGAGGCTTGAAAGA

guest30_0_1_87

Image 01

Genome: TTCTCAAGCTGTCCGAAGTGGCGCACACGG

camrobjones_0_1_19

Image 01

Genome: GTGAGAGCCATGGGGCGATGATTTCGCACTCCC