• Creator: sina12345
• Population: 1
• Generation: 5
• Total Fitness: 7
• No. Votes: 1
• Avg. Fitness 7
• Created: 05/19/2019
• Genome: AATATGGTGTGGTCGACTCCTATTTTCATAACCTAA
• Function:

  noise(sqrt(numbers('xyy') if numbers('xyy') if 2 *(numbers('xyy')) > numbers('rrr') else numbers('rrr') if numbers('xyy') > numbers('rep') else 2 *(numbers('xyy')) > numbers('xyy') if 2 *(numbers('xyy')) > numbers('rep') else numbers('rrr') else 2 *(numbers('xyy'))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.